|
|
In
Situ Hybridization
Housekeeping Genes
| Gene |
Species |
Tm |
Inc Temp Range (C) |
Wash Temp Range (C) |
Film Exp Range (days) |
Anti-sense Sequence |
Complementary to Sequences |
Length |
|
|
|
|
| GAPDH |
mouse |
49.1 |
33-38 |
35-41 |
5-9 |
gtgccgttgaatttgccgtgagtggagtcatactggaacatgtagacc |
169-216 |
48 |
| ELF2 |
mouse |
48.3 |
33-38 |
38-41 |
6-10 |
cccatctcagcagcctccttctcaaacttttcgatggttcgcttgtcg |
141-188 |
48 |
| cyclophilin |
mouse |
49.9 |
32-35 |
35-41 |
5-10 |
tctttggaactttgtctgcaaacagctcgaaggagacgcggcccaagg |
88-135 |
48 |
| transferrin receptor |
mouse |
47.4 |
32-38 |
35-41 |
7-20 |
ctgacttgtctgtctcctccgtttcagccagtttcacacactcctctt |
284-331 |
48 |
| betaActin |
mouse |
54.2 |
35-41 |
37-43 |
3-7 |
tcacccacataggagtccttctgacccattcccaccatcacaccttgg |
42-89 |
48 |
|
Molecular
Histology Center
Environmental and Occupational Health Sciences Institute, 170 Frelinghuysen
Road, Piscataway, NJ 08854
Phone: 732-445-3729 For additional information contact
ekr@eohsi.rutgers.edu
|
|
Updated on
Friday, June 03, 2005
|
|